Light Box

Selected items ()
Go to Light Box >

Latest ADA Updates

please login first!

»Move 36«
Light Box

Keywords

  • aesthetics
    • acoustic
    • affective
    • anamorphic
    • animated
    • anthropomorph
    • assembled
    • automated
    • autopoietic
    • collaborative
    • contextual
    • cybernetic
    • disgusting
    • documenting
    • duplicated
    • dynamic system
    • ephemeral
    • experimental
    • found object
    • generative
    • gustatory
    • hypermediacy
    • illusionary
    • immaterial
    • immersive
    • installation-based
    • interactive
    • intermedial
    • intervention
    • mobile
    • modular
    • multi-user
    • multiple
    • narrative
    • navigable
    • networked
    • olfactory
    • panoramatic
    • performative
    • polysensory
    • processual
    • projected
    • real-time
    • remediated
    • remixed
    • sculptural
    • site-specific
    • sonification
    • sublime
    • tactile
    • telematic
    • three-dimensional
    • time-based
    • uncanny
    • virtual
    • visual
  • genre
    • Bio Art
      • Genetic Art
      • Transgenic Art
    • Database Art
    • Digital Activism
    • Digital Animation
    • Digital Community (Social Network)
    • Digital Graphics
    • Game Art
    • Glitch Art
    • Hybrid Art
    • installation
      • interactive installation
      • performative installation
      • sound installation
      • Virtual Reality
        • Augmented Reality
        • Mixed Reality
    • Nano Art
    • Net Art
    • Performance
      • Computer performance
      • Happening
      • multimedia performance
      • sound performance
      • video performance
    • robotics
    • Telematic Art
  • subject
    • ART AND SCIENCE
      • algorithm
      • anthropology
      • archaeology
      • artificial intelligence
      • astronomy
      • biology
      • botany
      • cartography
      • code
      • combinatorics
      • cyberspace
      • database
      • documentation
      • evidence
      • experiment
      • geography
      • geometry
      • history of science
      • humanities
      • library
      • light
      • machine
      • mathematic
      • medicine
      • microscopy
      • nanotechnology
      • neuroscience
      • philosophy
      • physics
      • psychology
      • Representation of knowledge
      • research
      • science
      • scientific image
      • space
      • statistics
      • stereoscope
    • ARTS AND VISUAL CULTURE
      • allegory
      • animation
      • architecture
      • art history
      • art market
      • beauty
      • cinema
      • Concept Art
      • conservation
      • dance
      • expanded cinema
      • fashion
      • gaze
      • grid
      • illusion
      • literature
      • mask
      • materiality
      • mirror
      • model
      • museum
      • music
      • nude
      • panopticon
      • panorama
      • personification
      • perspective
      • poetry
      • projection
      • representativeness
      • shadow
      • sketch
      • spectator
      • symbolism
      • theatre
      • Theory
        • complexity
        • media theory
        • modernism
        • postmodernism
        • poststructuralism
        • semiotics
        • simulacrum
      • virtuality
      • visual culture
    • BODY AND HUMAN
      • agency
      • anatomy
      • body
      • breathing
      • cybersex
      • cyborg
      • death
      • disease
      • dream
      • embodiment
      • empathy
      • expression
      • eye
      • facial expression
      • fantasy
      • feeling
        • affect
        • emotion
      • gender
      • genetics
      • gesture
      • hand
      • human
      • identity
      • intimacy
      • movement
      • pain
      • perception
      • performativity
      • physiognomy
      • posthuman
      • self awareness
      • senses
      • sexuality
      • skin
      • speech
      • surgery
    • HISTORY AND MEMORY
      • ancestor
      • antiquity
      • archive
      • artifacts
      • collective memory
      • colonialism
      • cultural heritage
      • historical site
      • historism
      • history
      • meme
      • memorial
      • modern era
      • nostalgia
      • postcolonialism
      • preservation
      • romanticism
      • teleology
      • tradition
    • MEDIA AND COMMUNICATION
      • access
      • advertising
      • Big Data
      • broadcast
      • commerce
      • communication
      • electronic media
      • error message
      • film
      • global village
      • hypertext
      • information
      • intermediality
      • internet
      • language
      • media archaeology
      • open source
      • print media
      • radio
      • search engine
      • social media
      • telecommunication
      • telephone
      • television
      • video surveillance
      • visualisation
      • writing
    • NATURE AND ENVIRONMENT
      • agriculture
      • animal
      • anthropocentrism
      • atmosphere
      • catastrophe
      • DNA
      • earth
      • ecosystem
      • energy
      • environment
      • evolution
      • four elements
      • geology
      • global warming
      • globe
      • landscape
      • magnetism
      • nature
      • ocean
      • outer space
      • physical law
      • plant
      • pollution
      • sustainability
      • vegetation
      • water
      • weather
    • POWER AND POLITICS
      • authority
      • banking
      • censorship
      • conspiracy
      • democracy
      • discrimination
      • economy
      • equality
      • geopolitics
      • governance
      • heroism
      • human rights
      • imperialism
      • institution
      • law
      • manipulation
      • market
      • military
      • nationalism
      • patriarchy
      • politics
      • sovereignty
      • surveillance
      • terrorism
      • violence
      • warfare
    • RELIGION AND MYTHOLOGY
      • afterlife
      • Alchemy
      • bible
      • church
      • creation
      • crucifixion
      • esoterism
      • exodus
      • heretic
      • legend
      • mysticism
      • myth
      • mythological creature
      • mythology
      • paradise
      • religion
        • buddhism
        • christianity
        • islam
        • judaism
      • ritual
      • sacrifice
      • Saint
      • sin
      • spirituality
      • vision
      • worship
    • SOCIETY AND CULTURE
      • activism
      • capitalism
      • civilisation
      • community
      • consumption
      • counterculture
      • digital identity
      • diversity
      • ethnicity
      • feminism
      • globalization
      • individuality
      • information society
      • interculturalism
      • mass
      • mass culture
        • entertainment
        • parody
        • phantasmagoria
        • popular culture
        • spectacle
      • migration
      • minority
      • morality
      • native
      • otherness
      • participation
      • poverty
      • privacy
      • racism
      • territory
      • unemployment
      • urban space
      • voyeurism
      • wealth
      • working class
    • TECHNOLOGY AND INNOVATION
      • artificial life
      • cybernetics
      • development
      • digitization
      • electricity
      • emulation
      • engineering
      • history of technology
      • innovation
      • intelligent environment
      • invention
      • mechanics
      • military technology
      • mobility
      • nonhuman communication
      • optics
      • product design
      • production
      • robot
      • simulation
      • supercomputing
      • technophobia
      • telematics
      • telepresence
  • Technology
    • Display
      • Electronic displays
        • BOOM (Binocular Omni-Orientation Monitor)
        • CAVE (Computered Augmented Virtual Environment)
        • computer monitor
        • Electromechanical Display Device
        • Electronic Paper
        • flashlight
        • Head-up Display
        • Headphones
        • HMD (Head-mounted Display)
        • holography
        • laser
        • light-emitting diode
        • plasma
        • printer
        • projection screen
        • projector
        • robotic
        • speakers
        • VFD (Vacuum Florescent Display)
        • VRD (Virtual Retinal Display)
      • Non-electronic displays
        • body
        • Book
        • easel painting
        • globe
        • house wall
        • inflatable structure
        • mirror
        • paper
        • sculpture
        • shutter glasses
        • sofa
        • Somatosensory System / Tactile Feedback Technology
        • table
    • Hardware
      • camera
      • computer mouse
      • data glove
      • Joystick
      • MAC
      • Mobile Device
      • multi touchscreen
      • plotter
      • scanner
      • touchscreen
      • Video
      • Virtual Workbench
      • Virtuscope
      • webcam
    • interface
      • Automatic Identification and Data Capture (AIDC)
      • biometrics
      • Body sensor
        • Body Tracking
        • brainwave sensor
        • breathing sensor
        • Breathing-Balance-Interface-Vest
        • Endoscope
        • eye scanner
        • facial recognition system
        • Motion Capture
        • positiontracker
        • retina scanner
        • Speech Recognition
        • step sensor
      • camera recording
      • electromagnetism
      • interactive media
        • Auditory User Interface (AUI)
        • Augmented Reality Interfaces
        • breath based communication
        • Internet of Things (IoT)
        • Ludic Interface
        • MR-based (Mixed Reality) Interaction
        • Multi-Modal Interaction
        • tactile user interfaces
        • Tangible Acoustic Interface
        • Tangible User Interface (TUI)
        • Voice User interface
      • Non-electronic interface
        • bike
        • doll
        • furniture
        • plant
      • Soundgenerating device
        • Audiotape
        • keyboard
        • microphone
        • musical instrument
        • RFID (Radio-frequency Identification)
        • Speech Recognition
        • syntheziser
        • telephone
        • Theremin
        • turntable
        • voice analysis
        • Voice User Interface (VUI)
      • virtual balance
    • Software
      • C++
      • CGI/Perl
      • CSS
      • Global Positioning System (GPS)
      • ISDN
      • Java
      • Linux
      • Optical Character Recognition (OCR)
      • periscope
      • PHP
      • RFID (Radio-frequency Identification)
      • robotic interfaces
      • SGI Onyx2
      • softimage
      • software interface
      • Video
      • VRML
      • Wireless Sensor Network (WSN)
      • XML
1/6
723
Information
Cite
X
Archive of Digital Art (ADA). “Eduardo Kac - »Move 36«”. https://www.digitalartarchive.at/database/general/work/move-36.html (retrieved 2010-03-11). @online{ADAartistprofile, author = {Archive of Digital Art (ADA)}, title = {Eduardo Kac - »Move 36«}, url = {https://www.digitalartarchive.at/database/general/work/move-36.html}, urldate = {retrieved 2010-03-11}
Technology
Software
Through genetic modification, the leaves of the plants curl. In the wild these leaves would be flat. The "Cartesian gene" was coupled with a gene that causes this sculptural mutation in the plant, so that the public can see with the naked eye that the "Cartesian gene" is expressed precisely where the curls develop and twist.

The "Cartesian gene" was produced according to a new code I created especially for the work. In 8-bit ASCII, the letter C, for example, is: 01000011. Thus, the gene is created by the following associations between genetic bases and binary digits:



A = 00

C = 01

G = 10

T = 11



The result is the following gene with fifty-two bases:

CAATCATTCACTCAGCCCCACATTCACCCCAGCACTCATTCCATCCCCCATC

The creation of this gene is a critical and ironic gesture, since Descartes considered the human mind a "ghost in the machine" (for him the body was a "machine"). His rationalist philosophy gave new impetus both to the mind-body split (Cartesian dualism) and to the mathematical foundations of current computer technology.

Descriptions & Essays
"Move 36" explores the permeable boundaries between the human and the nonhuman, the living and the nonliving. The title of "Move 36" refers to the dramatic chess move made by computer Deep Blue against world champion Gary Kasparov in 1997 -- a chess match between the best player that ever lived and the best player that never lived. The installation includes a plant, especially created for the work, that uses the universal computer code (called ASCII) to produce a "Cartesian" gene, that is, a translation of Descartes' ontological statement "Cogito ergo sum" into a gene. As viewers walk into the space, they see a chessboard made of sand and earth, flanked by digital projections that evoke the players in absentia. The plant is rooted precisely in the square where the computer defeated the human, that is, where the "move 36" was made. EDUARDO KAC
Literature
Dixon, Steve and Barry Smith. Digital Performance: A History of New Media in Theatre, Dance, Performance Art and Installation. Leonardo Books, Cambridge, MA: MIT Press, 2006.
Kac, Eduardo. »GFP Bunny.« Kunstforum 158 (January-March 2002): 46-57.
Kac, Eduardo. »Gravitropism: Art and the Joys of Levitation.« In I Leviate, What´s Next, edited by Aleksandra Kostic, 88-97. Maribor, SL: Kibla, 2001.
Bosco, Roberta and Stefano Caldana. »Un Mundo Verde Fluorescente.« Ciberp@is Mensual , no. 15 (Octobre 2001).
Kac, Eduardo. »Arte Transgenikoa.« Zehar 45 (2001): 22-25.
Landa, Kepa, ed. Futuros Emergentes: Arte, Interactividad y Nuevos Medios. Valencia, ES: Institució Alfonse el Magnánim, Diputació de Valencia, 2000.
Kac, Eduardo. »Telepresence Art and Net Ecology.« In The Robot in the Garden: Telerobotics and Telepistemology on the Internet, edited by Ken Goldberg. Cambridge, MA: MIT Press, 2000.
Kac, Eduardo. »Telepresence Art and Net Ecology.« In The Robot in the Garden: Telerobotics and Telepistemology on the Internet, edited by Ken Goldberg. Cambridge, MA: MIT Press, 2000.
Becker, Carol. »GFP Bunny.« Art Journal 59, no. 3 (Fall 2000).
Becker, Carol. »GFP Bunny.« Art Journal 59, no. 3 (Fall 2000).
Kac, Eduardo. »Negotiating Meaning: The Dialogic Imagination in Electronic Art.« In Proceedings of Computers in Art and Design Education Conference, edited by UK University of Teesside. Teeside, UK: 1999.
Kac, Eduardo. »Genesis.« In Ars Electronica 1999: LifeScience, edited by Gerfried Stocker and Christine Schöpf. Wien, New York: Springer Verlag, 1999.
Kac, Eduardo. »Beyond the Screen: New Directions in Interactive Art.« Blimp: Film Magazine 40 (1999): 49-54.
Kac, Eduardo. »Eduardo Kac: Teleporting an Unkown State.« In Teleporting an Unknown State, edited by Peter Tomaz Dobrila and Aleksandra Kostic, 4-7. Maribor, Slovenia: KIBLA Maribor, 1998.
Kac, Eduardo. »Novos Rumos na Arte Interativa.« Veredas 3, no. 32 (August 1998): 12-15.
Kac, Eduardo. »Live from Mars.« Leonardo 31, no. 1 (1998): 1-2.
Kac, Eduardo. »Live from Mars.« Leonardo 31, no. 1 (1998): 1-2.
Kac, Eduardo. »Transgenic Art.« Leonardo Electronic Almanac 6, no. 11 (December 1998).
Kac, Eduardo. »A-positive.« In ISEA ´97 Program Guide, edited by The School of the Art Institute of Chicago, 62. Chicago: ISEA, 1997.
Kac, Eduardo. »Origin and Development of Robotic Art.« Art Journal 56, no. 3 (1997): 60-67.
Kac, Eduardo. »Origin and Development of Robotic Art.« Art Journal 56, no. 3 (1997): 60-67.
Kac, Eduardo. »Holopoetry und darüber hinaus.« Passauer Pegasus 15, no. 29/30 (1997): 106-119.
Kac, Eduardo and Marcel.li Antunez Roca. »Robotic Art.« Leonardo Electronic Almanac 5, no. 5 (May 1997).
Kac, Eduardo and Marcel.li Antunez Roca. »Robotic Art.« Leonardo Electronic Almanac 5, no. 5 (May 1997).
Kac, Eduardo, ed. New Media Poetry: Poetic Innovation and New Technologies. Vol.30. Visible Language, Rhode Island: Rhode Island School of Design, 1996.
Kac, Eduardo. »Interactive Art on the Internet.« In Ars Electronica 1995. Welcome to the Wired World, edited by Peter Weibel and Karl Gerber, 170-179. Wien, New York: Springer Verlag, 1995.
Kac, Eduardo. »Interactive Art on the Internet.« In Ars Electronica 1995. Welcome to the Wired World, edited by Peter Weibel and Karl Gerber, 170-179. Wien, New York: Springer Verlag, 1995.
Kac, Eduardo. »Eduardo Kac: Dialogues.« Dialogue: Arts in the Midwest 18, no. 1 (Jan/Feb 1995): 14-16.
Kac, Eduardo. »Essay Concerning Human Understanding.« Leonardo Electronic Almanac 3, no. 8 (August 1995).
Osthoff, Simone and Eduardo Kac. »Eduardo Kac -- The Aesthetics of Dialogue.« .
Kac, Eduardo. »Aspects of the Aesthetics of Telecommunications.« In Zero -- The Art of Being Everywhere, edited by Gerfried Stocker. Graz, Austria: Steirische Kulturinitiative Graz, 1993.
Kac, Eduardo. »Aspekte einer Ästhetik der Telekommunikation.« In Zero - The Art of Being Everywhere, edited by Gerfried Stocker. Graz, Austria: Steirische Kulturinitiative Graz, 1993.
Kac, Eduardo. »Holopoetry, Hypertext, Hyperpoetry.« In Proceedings of the Holographic Imaging Conference, edited by SPIE 2043, . Bellingham, WA: Holographic Imaging and Materials (Proc. SPIE 2043), Tung H. Jeong, Editor (Bellingham, WA: SPIE,, 1993.
Kac, Eduardo. »Aspects of the Aesthetics of Telecommunications.« In Siggraph Visual Proceedings, edited by John Grimes, 47-57. New York: 1992.
Kac, Eduardo. »On the Notion of Art as a Visual Dialogue.« In Art-Reseaux, edited by Karen O´Rourke, 20-23. Paris: Université de Paris I, Panthéon-Sorbonne, 1992.
Kac, Eduardo. »Ornitorrinco: Exploring Telepresence and Remote Sensing.« Leonardo 24, no. 2 (1991): 233.